View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18364_low_33 (Length: 271)
Name: NF18364_low_33
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18364_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 10024864 - 10024612
Alignment:
| Q |
1 |
aacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactcttaaacaacttttcattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10024864 |
aacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactctta---aacttttcattg |
10024768 |
T |
 |
| Q |
101 |
attatgcagcctgttatggttagattattaacccttttaagcca---------actggttccattaatgctagcagactatctcagcttgttcattttct |
191 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10024767 |
attatgcagcctgtt----ttagattattaacccttttaagccaactttgtacactggttccattaatgctagcagactatctcagcttgttcatttgct |
10024672 |
T |
 |
| Q |
192 |
acgcttaaacattggttatcttccatgcattcatatacttaggtgtccctatctttagag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10024671 |
acgcttaaacattggttatcttccatgcattcatatacttaggtgtccctatctttagag |
10024612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University