View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_high_16 (Length: 246)
Name: NF18365_high_16
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 230
Target Start/End: Complemental strand, 10044060 - 10043844
Alignment:
| Q |
11 |
agaagaagaagaacatcgagcttcctctccnnnnnnngaagatctcaaagaatggtgttccaaaagagacctacagaaccaaaatagttacggctccaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10044060 |
agaagaagaagaacatcgagcttcctctccaaaaaaagaagatctcaaagaatggtgttccaaaagagacctacagaaccaaaatagttacggctccaaa |
10043961 |
T |
|
| Q |
111 |
accaaaaaagttggcaaataatgatgaatttggagctgtgtggtcgccgttttatttttgatgattctgctgattttttaagaagattttgtggagataa |
210 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10043960 |
accaaaaaagttggcaaataatgataaatttggagctgtgtggtcgccgttttatttttgatgattctgctgatttttt---aagattttgtggagataa |
10043864 |
T |
|
| Q |
211 |
tggacgtggatcaaatgtga |
230 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
10043863 |
tggacctggatcaaatgtga |
10043844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University