View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_high_21 (Length: 237)
Name: NF18365_high_21
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_high_21 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 237
Target Start/End: Complemental strand, 8285455 - 8285238
Alignment:
| Q |
20 |
tatatgtaaaaattgatatatttttgttgttttaactgtctgattctcagaaagaggcttggtaatttcgagtttggcttaatcaaaaggcaagtctaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8285455 |
tatatgtaaaaattgatatatttttgttgtttaaactgtctgattctcagaaagcggcttggtaatttcgagtttggcttaatcaaaaggcaagtctaat |
8285356 |
T |
 |
| Q |
120 |
agaaaaaatgttccaactaaaatttaaactcaatttgttttaaacaattcatctttaattagaactaataacaactcgagttcaatcattagttttgtaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
8285355 |
agaaaaaatgttccaactaaaatttaaactcaatttgttttaaacaattcatctttaattagaactattaatgactcgagttcaatcattagttttgtaa |
8285256 |
T |
 |
| Q |
220 |
cgcttgatgatgattacc |
237 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
8285255 |
aacttgatattgattacc |
8285238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University