View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_low_13 (Length: 280)
Name: NF18365_low_13
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 453725 - 453574
Alignment:
| Q |
17 |
atttttgtgtttagttttaatggtattgatagatgtcgtgaatgatagttatataagtcaatcgtgcaatattatgcagttataagtggaaggaaattga |
116 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
453725 |
atttctgtgtttagttctaacggtattgatagatgtcatgaatgatagttatttaagtcaattgtgcaatattatgcagttataagtggaaggaaattga |
453626 |
T |
|
| Q |
117 |
ttttggagccacttaatggtggaaaagataacgtaaagggaggtggcgacta |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
453625 |
ttttggagccacttaatggtggaaaagataaggtaaagggaggtggcgacta |
453574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 54 - 141
Target Start/End: Complemental strand, 441350 - 441263
Alignment:
| Q |
54 |
gtgaatgatagttatataagtcaatcgtgcaatattatgcagttataagtggaaggaaattgattttggagccacttaatggtggaaa |
141 |
Q |
| |
|
||||||||| ||||| ||||| ||| ||| |||||||||||||| |||||||||||||| ||| || ||||||||| |||||||||| |
|
|
| T |
441350 |
gtgaatgatggttatttaagttaattgtgaaatattatgcagttttaagtggaaggaaaatgaccttagagccacttcatggtggaaa |
441263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University