View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_low_17 (Length: 246)
Name: NF18365_low_17
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 11835991 - 11835764
Alignment:
| Q |
19 |
ataatggggtgttacggttgtgatgccctcaagtatgtcataaccttctcataaacctaaaaattccacctacaagattttgaaatgcaaaaaacatggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11835991 |
ataatggggtgttacggttgtgatgccctcaagtatgtcataaccttctcataaacctaaaaattccacctacaagattttgaaatgcaaaaaacatggt |
11835892 |
T |
 |
| Q |
119 |
taaaaatagtagccacaagattttgtctgcatggccccatatataacagatatttgaaccataactccc-----aataacacagtgccctcatgcctcaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11835891 |
taaaaatagtagccacaagattttgtctgcatggccccatatacaacagatatttgaaccataactcccaagataataacacagtgccctcatgcctcaa |
11835792 |
T |
 |
| Q |
214 |
tccttctctataaaaccgcacaaatcct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
11835791 |
tccttctctataaaaccgcacaaatcct |
11835764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University