View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_low_4 (Length: 518)
Name: NF18365_low_4
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 231
Target Start/End: Complemental strand, 29586147 - 29585934
Alignment:
| Q |
18 |
gtatcttgtattgtccataaatgtcgaaattattgaccttgttggctgtgaacttgtttattccaaagaattggtttcaatcaaactgcaattcaattgt |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29586147 |
gtatcttgtattgtccataaatgtcaaaattattgaccttgttggctgtgaacttgtttattccaaattattggtttcaatcaaactgcaattcaattgt |
29586048 |
T |
 |
| Q |
118 |
gtcatccaatgggatatgatgcacccactttctgtcattcttgcttctatctttaacaagctttattttttcattcatgctgtacatgaagatatgcaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29586047 |
gtcatccaatgggatatgatgcacccactttctgtcattcttgcttctatctttaacaagctttattttttcattcatgctgtacatgaagatatgcaga |
29585948 |
T |
 |
| Q |
218 |
tttagttcaaagat |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
29585947 |
tttagttcaaagat |
29585934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University