View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18365_low_7 (Length: 434)
Name: NF18365_low_7
Description: NF18365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18365_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 3 - 281
Target Start/End: Original strand, 2035684 - 2035965
Alignment:
| Q |
3 |
aggaggagcacagaggaaaaacaat-ccaccacattcaatttatcattgaa-ctgcaaaatttgggagtcgatttacataagcacttcatacatctctcc |
100 |
Q |
| |
|
||||| |||||| |||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035684 |
aggagaagcacaaaggaaaaagaattccaccacattcaatttatcattgaaactgcaaaatttgggagtcgatttacataagcacttcatacatctctcc |
2035783 |
T |
|
| Q |
101 |
caactttattggttttgtttaactgttatatgttgcttcaataacaaaggtttaacgagattttcattatctcttggatgatcaaattcatcttattttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035784 |
caactttattggttttgtttaactgttatatgttgcttcaataacaaaggtttaacgagattttcattatctcttggatgatcaaattcatcttattttc |
2035883 |
T |
|
| Q |
201 |
gtgattttgttgcatctag-nnnnnnnnnactgttatatttggcttttgattgtattgtctttcttttgaacatgttgaatc |
281 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2035884 |
gtgattttgttgcatctagttttttttttactgttatatttggcttttgattgtattgtctttcttttgaacatgttgaatc |
2035965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 344 - 411
Target Start/End: Original strand, 2036028 - 2036095
Alignment:
| Q |
344 |
ctatgtccttaaacatttgctcattttgataaaaagaaatacaacttaccaatcttggattgaaattg |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2036028 |
ctatgtccttaaacatttgctcattttgataaaaagaaatacaacttaccaatcttggattgaaattg |
2036095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University