View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18367_high_10 (Length: 261)
Name: NF18367_high_10
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18367_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 244
Target Start/End: Complemental strand, 23758944 - 23758796
Alignment:
| Q |
96 |
cactagcaggggt-ggagctacaacaggggccaatgtaggccgtggtcccctcaagatttccattcttttttataccatgcttgctgatatggagtaaca |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23758944 |
cactagcagggggcggagctacaacaggggccaatgtaggccgtggtcccctcaagatttccattcttttt-ataccatgcttgctgatatggagtaaca |
23758846 |
T |
 |
| Q |
195 |
ctttaacatgatgattagtttccaaatatttcacttgttttgcatttatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23758845 |
ctttaacatgatgattagtttccaaatatttcacttgttttgcatttatt |
23758796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University