View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18367_high_17 (Length: 232)
Name: NF18367_high_17
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18367_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 37719272 - 37719076
Alignment:
| Q |
17 |
aatataccaaagaccgaaaccgatggatcagcttatgccacacgaaggaaaggacaagttgaagaagaaaagtaaggtggcttgactaactgcacatatc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37719272 |
aatataccaaagaccgaaaccgatggatcagcttatgccacacgaagaaaaggacaagttgaagaagaaaagtaaggtggcttgactaactgcacatatc |
37719173 |
T |
 |
| Q |
117 |
aacaacgaatggctaaaatttctacactgacttgtatatgacgacccattgaccattacaagatcacattaaattcaagtatgaatattgaacactc |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37719172 |
aacaacgaatggctaagatttctacactgacttgtatatgacgacccattgaccattacaagatcacattaaattcaagtatgaatattgaatactc |
37719076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University