View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18367_low_10 (Length: 261)

Name: NF18367_low_10
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18367_low_10
NF18367_low_10
[»] chr4 (1 HSPs)
chr4 (96-244)||(23758796-23758944)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 96 - 244
Target Start/End: Complemental strand, 23758944 - 23758796
Alignment:
96 cactagcaggggt-ggagctacaacaggggccaatgtaggccgtggtcccctcaagatttccattcttttttataccatgcttgctgatatggagtaaca 194  Q
    ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
23758944 cactagcagggggcggagctacaacaggggccaatgtaggccgtggtcccctcaagatttccattcttttt-ataccatgcttgctgatatggagtaaca 23758846  T
195 ctttaacatgatgattagtttccaaatatttcacttgttttgcatttatt 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
23758845 ctttaacatgatgattagtttccaaatatttcacttgttttgcatttatt 23758796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University