View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18367_low_12 (Length: 253)
Name: NF18367_low_12
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18367_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 41772500 - 41772734
Alignment:
| Q |
1 |
ttgactcattaaagacacatgagctgcagtcactgtggcagcagccaccactcctgcgtcattgctagcaatcgtattggctccatgaacattgttgccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772500 |
ttgactcattaaagacacatgagctgcagtcaccgtggcagcagccaccactcctgcgtcattgctagcaatcgtattggctccatgaacattgttgccg |
41772599 |
T |
|
| Q |
101 |
gcaccatcattagcacgagttgttgaaacatgcactttannnnnnnccttgtgactaggcttgccattggagagtttctctaaatcttccacttcgtttt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772600 |
gcaccatcattagcatgagttgttgaaacatgccctttatttttttccttgtgactaggcttgccattggagagtttctctaaatcttccacttcgtttt |
41772699 |
T |
|
| Q |
201 |
ccttactcttgtggtttttccttctaaggcagaaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41772700 |
ccttactcttgtggtttttccttctaaggcagaaa |
41772734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University