View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18367_low_14 (Length: 243)
Name: NF18367_low_14
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18367_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 27694850 - 27695057
Alignment:
| Q |
18 |
aggaagacagccacaatggtgtggccacaatgattcctggtatgaactatactgcaccgacaccaaccaaacggtgttagagcttcccttctcttcgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694850 |
aggaagacagccacaatggtgtggccacaatgattcctggtatgaactatactgcaccgacaccaaccaaacggtgttagagcttcccttctcttcgaaa |
27694949 |
T |
|
| Q |
118 |
accatcgtcaaaaccataaactacacttcacaaattataacagtatcttatcctgaattctgccttcacaaacagattcctaacttcaacatatcctcat |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694950 |
accatcctcaaaaccataaactacacttcacaaattataacagtatcttatcctgaattctgccttcacaaacagattcctaacttcaacatatcctcat |
27695049 |
T |
|
| Q |
218 |
cacctttt |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
27695050 |
cacctttt |
27695057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University