View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18367_low_16 (Length: 234)
Name: NF18367_low_16
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18367_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 34592464 - 34592262
Alignment:
| Q |
21 |
aatgatgctatatgtgtttgtaattttgatgcattaagacgatcttaatatcatggaaatgtatgacttttccttcttgatgcaatttgaaagccaatta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34592464 |
aatgatgctatatgtgtttgtaattttgatgcattaagacgatcttaatatcatggaaatgtatgacttttccttcttgatgcaatttgaaagccaatta |
34592365 |
T |
 |
| Q |
121 |
agcttattatttacttttgaaacatttcataaaataaattttaaacacccttcggtttttaaaactgtacctggcttaatcattcagttttttcatattc |
220 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
34592364 |
agcttattatttactttcaaaacatttcataaaataaattttaaacacccttcggtttttaaaactgtacctggcttaaccattcagttttttcattttc |
34592265 |
T |
 |
| Q |
221 |
ttc |
223 |
Q |
| |
|
||| |
|
|
| T |
34592264 |
ttc |
34592262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University