View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18368_high_13 (Length: 249)
Name: NF18368_high_13
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18368_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 36638890 - 36638661
Alignment:
| Q |
13 |
gagatacttgaaccccaaagctgaacggactgaaccgcgctgcaggctggaaggatagttgaacctgatgctgcaaagttgaatccttgatggaaatttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36638890 |
gagatacttgaaccccaaagctgaacggactgaaccgtgcttcaggctggaaggatagttgaacctgatgctgcaaagttgcatccttgatggaaatttg |
36638791 |
T |
|
| Q |
113 |
gcaagccaaaggaatccatataggcattcaagaatggcaagtccgttgcattcactgcatcaaaaaaccagaattggattgggatagaactatcatatga |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36638790 |
gcaagccaaagaaatccatataggcattcaagaatggcaagtccgttgcattcactgcatcaaaaaaccagaattggattgggatagaactatcatatga |
36638691 |
T |
|
| Q |
213 |
cagtgtaacctttctttcttatttccaaac |
242 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
36638690 |
cagcgtaacctttctttcttatttccaaac |
36638661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 58 - 171
Target Start/End: Complemental strand, 36634084 - 36633971
Alignment:
| Q |
58 |
gctggaaggatagttgaacctgatgctgcaaagttgaatccttgatggaaatttggcaagccaaaggaatccatataggcattcaagaatggcaagtccg |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||| |||| | ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
36634084 |
gctggaaggatagttgaacctgctgctgcaaagttgcatccgtgatggaaatttggcgagcccactgaatccagataggcatttaagaatggcaagtcca |
36633985 |
T |
|
| Q |
158 |
ttgcattcactgca |
171 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
36633984 |
ttgcatccactgca |
36633971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University