View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18368_low_11 (Length: 289)
Name: NF18368_low_11
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18368_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 20 - 177
Target Start/End: Complemental strand, 35787115 - 35786958
Alignment:
| Q |
20 |
ggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787115 |
ggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatg |
35787016 |
T |
|
| Q |
120 |
ctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787015 |
ctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 70
Target Start/End: Complemental strand, 25896674 - 25896641
Alignment:
| Q |
37 |
ttggggtaaatgggttgctgaaattcgtgaacca |
70 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
25896674 |
ttggggtaaatgggttgctgagattcgtgaacca |
25896641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 37 - 69
Target Start/End: Original strand, 52690554 - 52690586
Alignment:
| Q |
37 |
ttggggtaaatgggttgctgaaattcgtgaacc |
69 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
52690554 |
ttggggtaaatgggttgctgaaatccgtgaacc |
52690586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University