View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18368_low_16 (Length: 228)

Name: NF18368_low_16
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18368_low_16
NF18368_low_16
[»] chr7 (1 HSPs)
chr7 (16-210)||(46937981-46938175)
[»] chr1 (1 HSPs)
chr1 (63-174)||(36633973-36634084)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 46937981 - 46938175
Alignment:
16 gagacacctgaatcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatt 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46937981 gagacacctgaatcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatt 46938080  T
116 tggcaaacccaatgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaacatcattaggaagacga 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
46938081 tggcaaacccaatgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaatatcattaggaagacga 46938175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 63 - 174
Target Start/End: Complemental strand, 36634084 - 36633973
Alignment:
63 gctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatttggcaaacccaatgaatccaaatatgcatttaagaatggtaaatcca 162  Q
    |||||||||||||||||||| |||||||| ||||| || || |     ||||||||| | |||| |||||||| ||| |||||||||||||| || ||||    
36634084 gctggaaggatagttgaacctgctgctgcaaagttgcatccgtgatggaaatttggcgagcccactgaatccagataggcatttaagaatggcaagtcca 36633985  T
163 atgcatccactg 174  Q
     |||||||||||    
36633984 ttgcatccactg 36633973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University