View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18368_low_16 (Length: 228)
Name: NF18368_low_16
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18368_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 46937981 - 46938175
Alignment:
| Q |
16 |
gagacacctgaatcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46937981 |
gagacacctgaatcccaaaggagaaagggcagatggatgatgcagtggctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatt |
46938080 |
T |
|
| Q |
116 |
tggcaaacccaatgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaacatcattaggaagacga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46938081 |
tggcaaacccaatgaatccaaatatgcatttaagaatggtaaatccaatgcatccactgaaaacaacatccaagacaatatcattaggaagacga |
46938175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 63 - 174
Target Start/End: Complemental strand, 36634084 - 36633973
Alignment:
| Q |
63 |
gctggaaggatagttgaaccagctgctgcgaagttacaacctttcctaaaatttggcaaacccaatgaatccaaatatgcatttaagaatggtaaatcca |
162 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||| || || | ||||||||| | |||| |||||||| ||| |||||||||||||| || |||| |
|
|
| T |
36634084 |
gctggaaggatagttgaacctgctgctgcaaagttgcatccgtgatggaaatttggcgagcccactgaatccagataggcatttaagaatggcaagtcca |
36633985 |
T |
|
| Q |
163 |
atgcatccactg |
174 |
Q |
| |
|
||||||||||| |
|
|
| T |
36633984 |
ttgcatccactg |
36633973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University