View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18368_low_17 (Length: 225)
Name: NF18368_low_17
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18368_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 46355843 - 46356036
Alignment:
| Q |
19 |
atcacacacattatttacaccaaatatacaaggtattggtttactggtccataaacttgaagaataattcaggtgtgcatattaacgaaattggctttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46355843 |
atcacacacattatttacaccaaatatacaaggtattggtttactggtccataaacttgaagaataattcaggtgtgcatattaacgaaattggctttca |
46355942 |
T |
 |
| Q |
119 |
ggacttctatttgcattgcaatgttacaagagtttaaatagagcacacacttgtgactgcaacaacctttccatgcatcaatatccttcatctc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46355943 |
ggacttctatttgcattgcaatgttacaagagtttaaatagagcacacactcgtgactgcaacaacctttccatgcatcaatatcctttatctc |
46356036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University