View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18368_low_18 (Length: 219)
Name: NF18368_low_18
Description: NF18368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18368_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 37853378 - 37853561
Alignment:
| Q |
14 |
aacatatatgatttgaagaggaacttatcctaccaaagctgcaaacgaacagttctatcttcaaggtacattgttttcgacaaaaaatcaataccgatgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37853378 |
aacatatatgatttgaagaggaacttatcctaccaaagctgcaaacgaacagttctatcttcaaggtacattgttttcgacaaaaaatcaataccgatgg |
37853477 |
T |
 |
| Q |
114 |
tagcctgaaagtatatgatcaaattttctgttagctatctagcaacatagagggggaaatgtgaatgttgaaatgaaaattaac |
197 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37853478 |
tagcctgaaattatatgatcaaattttctgttagctatctagcaacatagagggggaaatgtgaatgttgaaatgaaaattaac |
37853561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 44 - 123
Target Start/End: Original strand, 39529046 - 39529125
Alignment:
| Q |
44 |
taccaaagctgcaaacgaacagttctatcttcaaggtacattgttttcgacaaaaaatcaataccgatggtagcctgaaa |
123 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||||||||||| |||||||| |||||||| || || |||||||| |
|
|
| T |
39529046 |
taccagagctgcaaacgaactgttcgatcttcaaggtacattgtttttgacaaaaagtcaataccaattgtcgcctgaaa |
39529125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University