View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_high_12 (Length: 389)
Name: NF18369_high_12
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 14 - 370
Target Start/End: Complemental strand, 14022013 - 14021657
Alignment:
| Q |
14 |
cataggtggtgttgttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattggtggtcatgctcttgatggttgcggtgag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14022013 |
cataggtggtgttgttggaaatggtaaagcaaggtatagagagtgtctgaagaatcatgctgtaggtattgggggtcatgctcttgatggttgcggtgag |
14021914 |
T |
|
| Q |
114 |
tttatgccggcaggaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgtta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021913 |
tttatgccggcaggaagtgaaggaactttggagtcactaaaatgtgctgcttgtaactgccaccgtaacttccaccgaaaagagtcatcggcagatgtta |
14021814 |
T |
|
| Q |
214 |
ctgccggtgacccttttctgttgacacaccatcatcaccatccaccacctccgccacagttcgcggcttattatcgaactccagcggggtatttgcatgt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14021813 |
ctgccggtgacccttttctgttgacacaccatcatcaccatccaccacctccgccacaattcgcggcttattatcgaactccagcggggtatttgcatgt |
14021714 |
T |
|
| Q |
314 |
atctggacagcagaggactgggacacttgctttgccatcaacttctggtggcggtgg |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
14021713 |
ttctggacagcagaggactgggacacttgctttgccgtctacttctggtggcggtgg |
14021657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 190
Target Start/End: Complemental strand, 2494714 - 2494675
Alignment:
| Q |
151 |
taaaatgtgctgcttgtaactgccaccgtaacttccaccg |
190 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2494714 |
taaaatgtgctgcttgtggctgccaccgtaacttccaccg |
2494675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University