View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_high_13 (Length: 389)
Name: NF18369_high_13
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 15 - 339
Target Start/End: Original strand, 50679175 - 50679503
Alignment:
| Q |
15 |
caaaggagcacgggttttagtggctaggtgtgtagtcatgattgcatttcaaattctttggaagtgtggttttgcctcatattcg----tcttcaaataa |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50679175 |
caaaggaacacgggttttagtggctaggtgtgtagtcatgattgcatttcaaattctttggaagtgtggttttgcctcatattcgatcgtcttcaaataa |
50679274 |
T |
 |
| Q |
111 |
attcatgcacttttggtcttcgttcgattatgttggctggttggatttataaaaatctcgtgcttttttatttgtttgcatgtagtagtttagatggttc |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50679275 |
attcatgcactttgggtcttcgttcgattatgttggctggttggatttataaaaatctcgtgcttttttaattgtttgcatgtagtagtttagatggttc |
50679374 |
T |
 |
| Q |
211 |
taaggagacttctcagtacatcaccatactattgagttagatattatttgagaattcatgcagataatgtttgtgacttgtgagggtgtttaagagaaga |
310 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50679375 |
tagggagacttctcagtacatcaccatactattgagttagatattatttgagaattcatgcagataatgtttgtgacttgtgagggtgtttaagagaaga |
50679474 |
T |
 |
| Q |
311 |
tgagatctaataacttagatccttttcct |
339 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50679475 |
tgagatctaataacttagatccttttcct |
50679503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University