View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_high_18 (Length: 249)
Name: NF18369_high_18
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 16827706 - 16827626
Alignment:
| Q |
10 |
attatactaatgttaacatgtagttccagaaagatcaattatcagacagaagtaaaataaagacagcttagaatcattaaa |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16827706 |
attatactaatgttaacatgtagttccagaaagatcaattatcagacagaagtaaaataaagacagcttagaatcattaaa |
16827626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 90
Target Start/End: Complemental strand, 29240170 - 29240090
Alignment:
| Q |
10 |
attatactaatgttaacatgtagttccagaaagatcaattatcagacagaagtaaaataaagacagcttagaatcattaaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29240170 |
attatactaatgttaacatgtagttccagaaagatcgattatcagaaagaagtaaaataaagacagcttagaatcattaaa |
29240090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University