View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_high_21 (Length: 240)
Name: NF18369_high_21
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 85 - 222
Target Start/End: Complemental strand, 38882009 - 38881874
Alignment:
| Q |
85 |
cagtgttaatgtgtgagtgagcgaaatagatggaggggagtagcaacaatttataaggaactaaaaacacatgcaagaaataaatgtgagtttaagctta |
184 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38882009 |
cagtgttaatgtgttagtgagcgaaatagatggaggg-agtggcaacaatttataaggaactaaaaacacatgcaagaaataaatgtgagttt-agctta |
38881912 |
T |
 |
| Q |
185 |
tcacaacaaacaaaatattccacccgcatatacttcct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38881911 |
ccacaacaaacaaaatattccacccgcatatacttcct |
38881874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University