View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_low_18 (Length: 252)
Name: NF18369_low_18
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_low_18 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 252
Target Start/End: Original strand, 783058 - 783301
Alignment:
| Q |
9 |
tattatactctcgcgttcttctttacacgtacagactaccatatttagttgctaatgttagaacatttcccgtagtaatagtaacttacttattgagcat |
108 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783058 |
tattatattctcgtgttcttctttacacgtacagattaccatatttagttgctaatgttagaacatttcccgtagtaatagtaacttacttattgagcat |
783157 |
T |
 |
| Q |
109 |
tgttgcatatcgatgttggagcttaattcatttggtggcaggtttcatatgggatattagagaaagtgtcacctgtgacacactcagtcggaaattgtgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
783158 |
tgttgcatatcgatgttggagcttaattcatttggtggcaggtttcatatgggatattagagaaagtgtcacctgtgacacactcagtcggaaattgcgt |
783257 |
T |
 |
| Q |
209 |
taagcgtgtcgttgtcatcgtctcttctgttatcttcttccaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783258 |
taagcgtgtcgttgtcatcgtctcttctgttatcttcttccaaa |
783301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University