View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_low_20 (Length: 246)
Name: NF18369_low_20
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 14022164 - 14022402
Alignment:
| Q |
1 |
cataactcttcatcttgttcctcttcttgatcttcatcaaaatccatttttgtagcaaaatttgaagttaggttatcaatggttgctttgatgtagtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022164 |
cataactcttcatcttgttcctcttcttgatcttcatcaaaatccatttttgtagcaaaatttgaagttaggttatcaatggttgctttgatgtagtgaa |
14022263 |
T |
 |
| Q |
101 |
taataatttgagctgaaagaagaaagaaaacaaaggaacattcactctcactttcactctttttctctatgtgc-nnnnnnnngttcaaaggaaaatttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14022264 |
taataatttgagctgaaagaagaaagaaaacaaaggaacattcactctcactttcactctttttctctatgtgctttttttttgttcaaaggaaaatttc |
14022363 |
T |
 |
| Q |
200 |
aatcttcatttgatattcatatacttttgaggttctgtg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14022364 |
aatcttcatttgatattcatatacttttgaggttctgtg |
14022402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University