View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18369_low_27 (Length: 201)
Name: NF18369_low_27
Description: NF18369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18369_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 35327208 - 35327021
Alignment:
| Q |
1 |
tcctcaccctcctgctcctgcacctgtccacacacctgttgctccagcacatccaccactacacccacctgttcacacccctgttgttccaactcaccct |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35327208 |
tcctcaccctcctgctcctacacctgtccacacacctgttgctccagcacatccaccactacacccacccgttcacacccctgttgttccaactcaccct |
35327109 |
T |
|
| Q |
101 |
ccattacacccacctgctccagcacacccaccattgcatcctactcccctccctagaagctttatagctgttcaaggtgttgtttatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35327108 |
ccattacacccacctgctccagcacacccaccattgcatcctactcccctccctagaagctttatagctgttcaaggtgttgtttatg |
35327021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 35335121 - 35335085
Alignment:
| Q |
152 |
cctagaagctttatagctgttcaaggtgttgtttatg |
188 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35335121 |
cctagaagcttaatagctgttcaaggtgttgtttatg |
35335085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University