View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_100 (Length: 247)
Name: NF1836_high_100
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_100 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 2228611 - 2228832
Alignment:
| Q |
9 |
agcagagaagtggttgtttgcgaagaatgttccatgtctatggagattagaggcaacatgggagaaaacgaagaggcaatcttaaagaaacaccgcagtt |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228611 |
agcagaaaagtggttgtttgcgaagaatgttccatgtctatggagatcagaggcaacatgggagaaaacgaagaggcaatcttaaagaaacaccgcagtt |
2228710 |
T |
 |
| Q |
109 |
cagggaagtgcgaccctagcaagaagaagaaaccgacttgccccgtgaagcgttgcaaggagattttgacgttttctaacacaagtacttgtaaaacttg |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2228711 |
cagggaagtgtgaccctagcaagaagaagaaaccgacttgccctgtgaagcgttgcaaggagattttgacgttttctaacacaagtacttgtaaaacttg |
2228810 |
T |
 |
| Q |
209 |
ccacattaaggtgtgtctcaag |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2228811 |
ccacattaaggtgtgtctcaag |
2228832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University