View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_101 (Length: 247)
Name: NF1836_high_101
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_101 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 48900577 - 48900355
Alignment:
| Q |
19 |
tctgtctgtaatctgattttgattaactaatttgtgaatttcagcttcatttgctacctaattggtaattgccactgtttatgcttaattgttctgtaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48900577 |
tctgtctgtaatctgattttgattaactaatttgtgaatttcagcttcatttgctacctaattggtaattgccactgtttatgcttaattgctctgtaat |
48900478 |
T |
 |
| Q |
119 |
tagtgttactgatcaagttttgcagagttttttcatgatgattaactaatttgagaatcttaaattcaattgatacttaattgtttgcttctgcatatgc |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48900477 |
tagtgttactgatcaagttttgc-gagttttttcatgatgattaactaatttgagaatcttaaattcaattgatacttaattgtttgcttctgcatattc |
48900379 |
T |
 |
| Q |
219 |
ttgattactgtgtaagctaaacct |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48900378 |
ttgattactgtgtaagctaaacct |
48900355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 11232019 - 11232240
Alignment:
| Q |
19 |
tctgtctgtaatctgattttgattaactaatttgtgaatttcagcttcatttgctacctaattggtaattgccactgtttatgcttaattgttctgtaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11232019 |
tctgtctgtaatctgattttgattaactaatttgtgaatttcagcttcatttgctacctaattggtaattgccactgtttatgcttaattgctctgtaat |
11232118 |
T |
 |
| Q |
119 |
tagtgttactgatcaagttttgcagagttttttcatgatgattaactaatttgagaatcttaaattcaattgatacttaattgtttgcttctgcatatgc |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11232119 |
tagtgttactgatcaagttttgc-gagttttttcatgatgattaactaatttgagaatcttaaattcaattgatacttaattgtttgcttctgcatatga |
11232217 |
T |
 |
| Q |
219 |
ttgattactgtgtaagctaaacc |
241 |
Q |
| |
|
||||||||||||| | ||||||| |
|
|
| T |
11232218 |
ttgattactgtgtgaactaaacc |
11232240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University