View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_102 (Length: 244)
Name: NF1836_high_102
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_102 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 46824143 - 46824375
Alignment:
| Q |
1 |
gttcagtgtatatgctgcgaattattgaagg-ggagtggaactctgtgactctctgcactgtgaaaatgttaaagttactagtttcagtgtcctcttcgt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46824143 |
gttcagtgtatatgctgcgaattattgaaggtggagtggaactctgtgactctctgcactgtgaaaatgttaaagttactagtttcagtgtcctctttgt |
46824242 |
T |
|
| Q |
100 |
ttgctcttatatatcctctttccatttattgtttgaaaattaaccacatggaaacattctacctatacattattaatactgcttacattggtagatttca |
199 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
46824243 |
ttgctcttat----cctctttccatttattgtttgaaaattaaccacatggagacattctacctatacattattaatactgctgacattggtaaatttca |
46824338 |
T |
|
| Q |
200 |
atttaaaattcaaatgtttgagtatttattgatgatg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46824339 |
atttaaaattcaaatgtttgagtatttattaatgatg |
46824375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University