View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_112 (Length: 235)
Name: NF1836_high_112
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 38623080 - 38622875
Alignment:
| Q |
1 |
gtaacgtaaacaatcatcaaagatacgtggtggctagggagggcccaccaatgtgaacttggtcaaaccaaactacataagaagacagggttggttatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38623080 |
gtaacgtaaacaatcatcaaagatacgtggtggctagggagggcccaccaatgtgaacttggtcaaaccaaactacataagaagacagggttggttatta |
38622981 |
T |
 |
| Q |
101 |
atggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagt-ggtgggtacgaggagttaccaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38622980 |
atggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagtgggtgggtacgaggagttaccaaa |
38622881 |
T |
 |
| Q |
200 |
ccaaaa |
205 |
Q |
| |
|
|||||| |
|
|
| T |
38622880 |
ccaaaa |
38622875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University