View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_113 (Length: 231)
Name: NF1836_high_113
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_113 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 3310290 - 3310201
Alignment:
| Q |
12 |
gataattctaaaactcatatcttagaagaagaaaagtgtgatatccttttaatcatcgagtgtttaggaggaaaagctgtgacaacttga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3310290 |
gataattctaaaactcatatcttagaagaagaaaagtgtgatatccttttaatcatctagtgtttaggaggaaaagctgtgacaacttga |
3310201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 3310130 - 3310089
Alignment:
| Q |
172 |
agatcattttaaaactttgtcttgctagaacacacgttatac |
213 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3310130 |
agatcattttaaaattttgtcttgctagaacacacgttatac |
3310089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University