View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_121 (Length: 215)
Name: NF1836_high_121
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_121 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 47426089 - 47425905
Alignment:
| Q |
16 |
atgaacaaccaaattacatatgatatcctttttacatttgattagtatgacatcat--tcggcacaatgaatttatagcaacttccggctaacataatcg |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47426089 |
atgaacaaccaaattacgtatgatatcctttttacatttgattagtatgacatcatattcggcacaatgaatttatagcaacttccagctaacataatcg |
47425990 |
T |
|
| Q |
114 |
tccaaatctggagaattaaaaaatttaaatacctagtgagaaaaggctttaatatatgtttttctagttttggctttacactact |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47425989 |
tccaaatctggagaattaaaaaatttaaatacctagtgagaaaaggctttaatatatgtttttctagttttggctttatactact |
47425905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 16 - 133
Target Start/End: Complemental strand, 50432303 - 50432185
Alignment:
| Q |
16 |
atgaacaaccaaattacatatgatatcctttttacatttga-ttagtatgacatcattcggcacaatgaatttatagcaacttccggctaacataatcgt |
114 |
Q |
| |
|
||||| ||||||||| | ||||||||||| || |||| | ||||||||||||| ||| |||||||||||||||||||| |||| || || ||||| || |
|
|
| T |
50432303 |
atgaagaaccaaatttcgcatgatatccttcatatattttaattagtatgacatcgttcagcacaatgaatttatagcaatttccagccaatataatagt |
50432204 |
T |
|
| Q |
115 |
ccaaatctggagaattaaa |
133 |
Q |
| |
|
|||| |||| ||||||| |
|
|
| T |
50432203 |
ttaaatatggaaaattaaa |
50432185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University