View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_41 (Length: 415)
Name: NF1836_high_41
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 126 - 398
Target Start/End: Complemental strand, 16645781 - 16645509
Alignment:
| Q |
126 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645781 |
aaatgtccaacttgttatgatcaattaagtattttctagttttggaagatattgtcacatagacatattaagaccctcaagaatcagtatgagtcactct |
16645682 |
T |
 |
| Q |
226 |
cttatccactttttgatatcaattggttgcttgcatgaatgatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645681 |
cttatccactttttgatatcaattggttgcttgcatgaatgatttttcacctccgacaagaaatacaggaagagacacgtagtgcttatagtattcaagg |
16645582 |
T |
 |
| Q |
326 |
acttgacatgtgtagccatatcttgttgtttcacaacctaacatataaataatcgcagaactcacgaccctgt |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16645581 |
acttgacatgtgtagccatatcttgttgtttcacaacccaacatataaataatcgcagaactcacgaccctgt |
16645509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University