View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_high_53 (Length: 361)
Name: NF1836_high_53
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 18 - 322
Target Start/End: Original strand, 45122700 - 45123004
Alignment:
| Q |
18 |
gaatatttgttagagatgtgccacgaagaaaaagagtttgttcgtgacttcatggcacagccggtagctggagctgcagttgccgccaccgagagtagca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45122700 |
gaatatttgttagagatgtgccacgaagaaaaagagtttattcgtgacttcatggcacagccggtagctggagctgccgttgccgccaccgagagtagca |
45122799 |
T |
 |
| Q |
118 |
gtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcattatctctttgaataactccgcggcaatacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45122800 |
gtgagatgattgtagtctctgatgagtcacctgagcttcttcctccgtccacatcctctagagcttgcattatctctttagataactccgcggcaatacc |
45122899 |
T |
 |
| Q |
218 |
gttaccagctgtgatgtccaaatccaaaccaccacggtgtcccacaaaaaagaggacttctgagagaggaaaaggagaaaagaagaatattaaaactcta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122900 |
gttaccagctgtgatgtccaaatccaaaccaccacggtgtcccacaaaaaagaggacttctgagagaggaaaaggagaaaagaagaatattaaaactcta |
45122999 |
T |
 |
| Q |
318 |
gatca |
322 |
Q |
| |
|
||||| |
|
|
| T |
45123000 |
gatca |
45123004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 321 - 350
Target Start/End: Original strand, 45123099 - 45123128
Alignment:
| Q |
321 |
caaattatttactcgtttattcctttgctt |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45123099 |
caaattatttactcgtttattcctttgctt |
45123128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University