View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_104 (Length: 250)
Name: NF1836_low_104
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_104 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 40 - 250
Target Start/End: Complemental strand, 14694789 - 14694579
Alignment:
| Q |
40 |
atatgtttgtacttcataggttacaactcatatataaacactacaattcaaaagacaagtatacccttgaattgtacctcgctcgtccctacccatctaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14694789 |
atatgtttgtacttcataggttacaactcatatataaacactacaattcaaaagacaagtatacccttgaattgtacctcgctcgtccctacccatctaa |
14694690 |
T |
|
| Q |
140 |
cactgtctatgagccatacttaattgcacttgtgtttgtcattattgattgacttgatcaacatatgaggtgcattctctaaagtacgtacgaatctctt |
239 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
14694689 |
cactgtctatgagccatacttgattgcacttgtgtttgtcattattgattgacttgatcaacatatgaggtgcattctctaaagcacgtacgaatctttt |
14694590 |
T |
|
| Q |
240 |
aaagtaatatt |
250 |
Q |
| |
|
||||||||||| |
|
|
| T |
14694589 |
aaagtaatatt |
14694579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 14694847 - 14694805
Alignment:
| Q |
14 |
atcacatcctatattttagttgtaacatatgtttgtacttcat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14694847 |
atcacatcctatattttagttgtaacatatgtttgtacttcat |
14694805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University