View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_105 (Length: 249)
Name: NF1836_low_105
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_105 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 14 - 233
Target Start/End: Original strand, 54770213 - 54770418
Alignment:
| Q |
14 |
gcaaaggcatgaatagtcggtcggacttagtggtagagcaccatatatcacatatataccagctgacttgtattgacagctaaatttcaagagatcaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54770213 |
gcaaaggcatgaatagtcggtcggacttagtggtagagcaccatatatcacatatat----------------tgacagctaaatttcaagagatcaata |
54770296 |
T |
 |
| Q |
114 |
aaaaccagactatatacacactagt--tatacccttttcattaacaagttttggaccattgtnnnnnnnntatgtatccaacatttaatttcttaaaata |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
54770297 |
aaaaccagactatatacacactagttatatacccttttcattaacaagttttggaccatcgtaaaaaaaaaatatatccaacatttaatttcttaaaata |
54770396 |
T |
 |
| Q |
212 |
aaattgagaaaaatgttaattt |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
54770397 |
aaattgagaaaaatgttaattt |
54770418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University