View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_111 (Length: 241)
Name: NF1836_low_111
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_111 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 34135033 - 34135258
Alignment:
| Q |
8 |
gatgaaacatacctttgtttaggcatacttaagtgaaagcattacatactgatattaaacgttaacttatcttaaatagatcctgcgggttctttgttat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34135033 |
gatgaaacatacctttgtttaggcatacttaagtgaaagcattacatactgatattaaacgttaacttatcttaaatagatcctgcgggttctttgttat |
34135132 |
T |
 |
| Q |
108 |
gtttaggatggggtaagcggaaactatcaaacatctattattggagtgtgacttttataagaatgtttggcattaggctctttggtggcgtacatatatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34135133 |
gtttaggatggggtaagcggaaactatcaaacatctattattggagtgtgacttttataagaatgttaggcattaggttctttggtggcgtacatatatt |
34135232 |
T |
 |
| Q |
208 |
taggaatgaaatttgtgtttcttttc |
233 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
34135233 |
taggaatgaaatttgtgtttgttttc |
34135258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University