View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_116 (Length: 238)
Name: NF1836_low_116
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_116 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 127 - 221
Target Start/End: Original strand, 26261262 - 26261356
Alignment:
| Q |
127 |
catgtaattatgagatttcaacatggattgtcatcttgatattagtggagtccctcaattacacagattataaactaaaattttgacatctaata |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26261262 |
catgtaagtatgagatttcaacatggattgtcatcttgatattagtggagtccctcaattacacagattataaactaaaattttgacatctaata |
26261356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 70
Target Start/End: Original strand, 26261174 - 26261214
Alignment:
| Q |
30 |
tctcacaaaacagtgagtttgtgtgaatcgattcacacatt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26261174 |
tctcacaaaacagtgagtttgtgtgaatcgattcatacatt |
26261214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University