View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_118 (Length: 236)
Name: NF1836_low_118
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 12144979 - 12145199
Alignment:
| Q |
1 |
agctgttctataagatcttgatgataaatttcttgataagccagcctcacaagttttctttgagcttcatttcggtgtgctagtacagatataatcgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12144979 |
agctgttctataagatcttgatgataaatttcttgataagccagcctcacaagttttctttgagcttcatttcggtgtgctagtacagatataatcgcag |
12145078 |
T |
 |
| Q |
101 |
tttcatctgtcccaaatcctgtacccgat-nnnnnnnnnnnncatatttagtactctgacaatgcctcgaataaaattgattccctttgttattagacat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12145079 |
tttcatctgtcccaaatcctgtacccgataaaaaaaaaaaaacatatttagtactctgacaatgcctcgaataaaattgattccctttgttattagacat |
12145178 |
T |
 |
| Q |
200 |
gaatatgttaaatattattag |
220 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
12145179 |
gaatatgttaagtattattag |
12145199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University