View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_120 (Length: 235)
Name: NF1836_low_120
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_120 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 107 - 228
Target Start/End: Original strand, 30490156 - 30490270
Alignment:
| Q |
107 |
tgtgttaatcaatacaagaggaaggtatgcgcggatgggatagaattttatgttagtatttgatattgagaatttgggttgacttgctgacactgtatac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
30490156 |
tgtgttaatcaatacaagaggaaggtatgcgcggatgggataga-----atgttagtatttgataatgagaatttggcgagacttgatgacactgtatac |
30490250 |
T |
 |
| Q |
207 |
tttgtgtttgtggcttgttata |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30490251 |
--tgtgtttgtggcttgttata |
30490270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 107 - 228
Target Start/End: Original strand, 30520963 - 30521084
Alignment:
| Q |
107 |
tgtgttaatcaatacaagaggaaggtatgcgcggatgggatagaattttatgttagtatttgatattgagaatttgggttgacttgctgacactgtatac |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||||| |||||||| | | |||| |||||||||||||||| || |||||||| |||||| |||||||||||| |
|
|
| T |
30520963 |
tgtgttaatcaaaacaggaggaaggtatgtgcggatggcacataattgcatgttagtatttgatactgtgaatttggcaagacttgatgacactgtatat |
30521062 |
T |
 |
| Q |
207 |
tttgtgtttgtggcttgttata |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30521063 |
tttgtgtttgtggcttgttata |
30521084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 30490050 - 30490086
Alignment:
| Q |
1 |
gatatgggtactactgttgttgggatctaaatgatgc |
37 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30490050 |
gatatgggtactactgtggttgggatctaaatgatgc |
30490086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University