View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1836_low_121 (Length: 235)

Name: NF1836_low_121
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1836_low_121
NF1836_low_121
[»] chr3 (1 HSPs)
chr3 (1-205)||(38622875-38623080)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 38623080 - 38622875
Alignment:
1 gtaacgtaaacaatcatcaaagatacgtggtggctagggagggcccaccaatgtgaacttggtcaaaccaaactacataagaagacagggttggttatta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38623080 gtaacgtaaacaatcatcaaagatacgtggtggctagggagggcccaccaatgtgaacttggtcaaaccaaactacataagaagacagggttggttatta 38622981  T
101 atggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagt-ggtgggtacgaggagttaccaaa 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38622980 atggagttgttttgttgttactacttgtttcagcgtgtaagtgagtgggggaataaacaagaagcctgatgggagtgggtgggtacgaggagttaccaaa 38622881  T
200 ccaaaa 205  Q
    ||||||    
38622880 ccaaaa 38622875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University