View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1836_low_122 (Length: 231)

Name: NF1836_low_122
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1836_low_122
NF1836_low_122
[»] chr6 (2 HSPs)
chr6 (12-101)||(3310201-3310290)
chr6 (172-213)||(3310089-3310130)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 12 - 101
Target Start/End: Complemental strand, 3310290 - 3310201
Alignment:
12 gataattctaaaactcatatcttagaagaagaaaagtgtgatatccttttaatcatcgagtgtttaggaggaaaagctgtgacaacttga 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
3310290 gataattctaaaactcatatcttagaagaagaaaagtgtgatatccttttaatcatctagtgtttaggaggaaaagctgtgacaacttga 3310201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 3310130 - 3310089
Alignment:
172 agatcattttaaaactttgtcttgctagaacacacgttatac 213  Q
    |||||||||||||| |||||||||||||||||||||||||||    
3310130 agatcattttaaaattttgtcttgctagaacacacgttatac 3310089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University