View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_124 (Length: 226)
Name: NF1836_low_124
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_124 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 4876925 - 4877115
Alignment:
| Q |
19 |
cagactgaagaaggaatcttgatgaagattgttgaaggatcacttggatagaagatattaaggattgaggtgttgagttttttgatttcaagcccgaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4876925 |
cagactgaagaaggaatcttgatgaagattgttgaaggatcacttggatagaagatattaagaattgaggtgttgagttttttgatttcaagcccgaatc |
4877024 |
T |
|
| Q |
119 |
aagttgaaggtgatcttcctacaattggaaggtcgtagattactataatcaaacattatcgcacttgcgtgcaaacattcaatcatagtgg |
209 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4877025 |
aagttgaaggtgatcttcctacaactggaaggtcgtagaatactataatcaaacattatcgcacttgcgtgcaaacattcaatcatagtgg |
4877115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 31692440 - 31692473
Alignment:
| Q |
26 |
aagaaggaatcttgatgaagattgttgaaggatc |
59 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
31692440 |
aagaagggatcttgatgaagattgttgaaggatc |
31692473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University