View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1836_low_135 (Length: 208)

Name: NF1836_low_135
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1836_low_135
NF1836_low_135
[»] chr2 (1 HSPs)
chr2 (15-189)||(37589359-37589533)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 189
Target Start/End: Complemental strand, 37589533 - 37589359
Alignment:
15 aggggaagattcttttcgaaagaaagaatttattaatagaagtggaaatcagcatgctaaaaattcttccaggtgggagaatgcgcagccgaggaatgta 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37589533 aggggaagattcttttcgaaagaaagaatttattaatagaagtggaaatcagcatgctaaaaattcttccaggtgggagaatgcgcagccgaggaatgta 37589434  T
115 aggaccagttcaaagattattgatgatgagaaaaatgcatacagcaatggtaaggatcatacccgagattatact 189  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37589433 aggaccagttcaaagattgttgatgatgagaaaaatgcatacagcaatggtaaggatcatacccgagattatact 37589359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University