View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_136 (Length: 205)
Name: NF1836_low_136
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_136 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 181
Target Start/End: Original strand, 55987857 - 55988025
Alignment:
| Q |
13 |
atgaagataaagctgataaaaagcagtcagcattctaaagcttttcttgctgcctaatttcatattccaggtgatgattctaatggatgtaatgatttat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55987857 |
atgaagataaagctgataaaaagcagtcagcattctaaagcttttcttgctgcctaatttcatattccaggtgatgattctaatggatgtaatgatttat |
55987956 |
T |
 |
| Q |
113 |
catctatgaaaagtgaaaacagtattattccacattaacgtgtgccagtgttgcccagattaaagttaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55987957 |
catctatgaaaagtgaaaacagtattattccacattaacgtgtgccagtgttgcccagattaaagttaa |
55988025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University