View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_49 (Length: 400)
Name: NF1836_low_49
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_49 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 17 - 390
Target Start/End: Complemental strand, 42446812 - 42446439
Alignment:
| Q |
17 |
aaatatgaaatagtaacatgacatcaaatgattggatgttgggtaacatatccaataaaactccaatctaatggtgttttcacannnnnnnctttctatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42446812 |
aaatatgaaatagtaacatgacatcaaatgattggatgttgggtaacatatccaataaaactccaatctaatggtgttttcacatttttttctttctatt |
42446713 |
T |
|
| Q |
117 |
aatgttgtagctagtagggcaattttctgaccattgcatttgttctcttgtagtacaagctgttgcttggcttcatcattgtcttatgtgaaattgacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42446712 |
aatgttgtagctagtagggcaattttctgaccattgcatttgttctcttgtagtacaagctgttgcttggcttcattattgtcttatgtgaaattgacca |
42446613 |
T |
|
| Q |
217 |
agataggactcctgacagtgtgtttagcagaaacccattttagaaatccttgaccgtgttctactgtcttatgaccggaccctatacggttgaatgttac |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446612 |
agataggactcctgacagtgtgtttagcagaaacccattttagaaatccttgaccgtgttctactgtcttatgaccggaccctatacggttgaatgttac |
42446513 |
T |
|
| Q |
317 |
tgaatatgtctgtttctggttggcttctgaaaagtagagcttgtttggatggacgctcacatcaactccctttg |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42446512 |
tgaatatgtctgtttctggttggcttctgaaaagtagagcttgtttggatggacgctcacatcaactccttttg |
42446439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University