View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_60 (Length: 350)
Name: NF1836_low_60
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 6e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 153 - 337
Target Start/End: Complemental strand, 10576624 - 10576441
Alignment:
| Q |
153 |
tttatgaccaatatatggatatccctgatagccacaaaaatagttttaaatgtttaagacaatgcaaatgtacatcaaagggtccccagaggctaactaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10576624 |
tttatgaccaatatatggatatccctgatagccacgaaaatagttttaaatgtttaagacaatgcaaatgtacatcaaagggtccc-agaggctaactaa |
10576526 |
T |
 |
| Q |
253 |
ctctcaattgagaggctttgtgacttgaattgggtgcatatatgaggatgcatgaattgtgacaagaactcttttctcctctcct |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576525 |
ctctcaattgagaggctttgtgacttgaattgggtgcatatatgaggatgcatgaattgtgacaagaactcttttctcctctcct |
10576441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 23 - 162
Target Start/End: Complemental strand, 10576990 - 10576851
Alignment:
| Q |
23 |
aaaataaaatcaatacagaataggaaattaggaatagtgaactttgtcgatgcatcacctcacctcaaccatggcaagaacgagatgaccagatgtccaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10576990 |
aaaataaaatcaatacagaataggaaattaggaatagtgaactttgttgatgcatcacctcacctcaaccatagcaagaacgagatgaccagatgtccaa |
10576891 |
T |
 |
| Q |
123 |
gaatctaaaatcaacttacagaacaatacttttatgacca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576890 |
gaatctaaaatcaacttacagaacaatacttttatgacca |
10576851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University