View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_69 (Length: 320)
Name: NF1836_low_69
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_69 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 6803749 - 6803943
Alignment:
| Q |
1 |
taaatagttaaaaattcaaacaactaccacctttaatttttcaactactttttcataagcactactgaataatataatgttgttaatgctatttggaatc |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803749 |
taaatagttaaaaatctaaacaactaccgcctttaatttttcaactactttt-cataagcactactgaataatataatgttgttaatgctatttggaatc |
6803847 |
T |
|
| Q |
101 |
annnnnnnaagagtctatttgaaatcattatcattcactaatgtttatactttattattatttttattcaaattggggtttggagtttttataaca |
196 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803848 |
atttttttaagagtctatttgaaatcattatcattcactaatgtttatactttattattatttttattcaaattggggtttggagtttttataaca |
6803943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 6803679 - 6803748
Alignment:
| Q |
1 |
taaatagttaaaaattcaaacaactaccacctttaatttttcaactactttttcataagcactactgaat |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6803679 |
taaatagttaaaaattcaaacaactaccacctttaatttttcaactactttttcataagcactactgaat |
6803748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University