View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_76 (Length: 296)
Name: NF1836_low_76
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 4612874 - 4613103
Alignment:
| Q |
19 |
aagtccctctcttttcccatctattagctatagctgtagtattttctttgaaaataataattgagaacaagttatgaatgtgtttgatgctatataatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612874 |
aagtccctctcttttcccatctattagcta--gctgtagtattttctttgaaaataataattgagaacaagttatgaatgtgtttgatgctatataatgg |
4612971 |
T |
 |
| Q |
119 |
caggttgactttgacatgcatatgtccatgctgtctttgcgtgaccctcatagttgaatttgctctggctctcatcaaggctccaattaaggttatggag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4612972 |
caggttgactttgacatgcatatgtccatgctgtctttgcgtgaccctcatagttgaatttgctctggctctcatcaaggctccaattaaggttatggag |
4613071 |
T |
 |
| Q |
219 |
tggttcacatccaagattccatgttagaagag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4613072 |
tggttcacatccaagattccatgttagaagag |
4613103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University