View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_79 (Length: 294)
Name: NF1836_low_79
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 8438600 - 8438719
Alignment:
| Q |
15 |
agcagagaaacaagagttggaggagattgggaaagaagagtatgggaat-gataaaaaatcatatcctctttgcttaattcatatgtggtacttattcac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438600 |
agcagagaaacaagagttggaggagattgggaaagaagagtatgggaattgataaaaaatcatatcctctttgcttaattcatatgtggtacttattcac |
8438699 |
T |
|
| Q |
114 |
cacacgtgtcttttcatttt |
133 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8438700 |
cacacgtgtcttttcatttt |
8438719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University