View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1836_low_79 (Length: 294)

Name: NF1836_low_79
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1836_low_79
NF1836_low_79
[»] chr1 (1 HSPs)
chr1 (15-133)||(8438600-8438719)


Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 8438600 - 8438719
Alignment:
15 agcagagaaacaagagttggaggagattgggaaagaagagtatgggaat-gataaaaaatcatatcctctttgcttaattcatatgtggtacttattcac 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
8438600 agcagagaaacaagagttggaggagattgggaaagaagagtatgggaattgataaaaaatcatatcctctttgcttaattcatatgtggtacttattcac 8438699  T
114 cacacgtgtcttttcatttt 133  Q
    ||||||||||||||||||||    
8438700 cacacgtgtcttttcatttt 8438719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University