View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1836_low_82 (Length: 287)
Name: NF1836_low_82
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1836_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 46309190 - 46309470
Alignment:
| Q |
1 |
cttttggcaagatattattttactttttggatcgacgcttattttgtgactgttgatatggttgtatggtgtaattaaatagcaacacctt-atgtgttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46309190 |
cttttggcaagatattattttactttttggatcgacgcttattttgtgaccgttgatatggttgtatggtgtaattaaatagcaacacctttatgtgttt |
46309289 |
T |
|
| Q |
100 |
atgttggaaatttttggcaagatatggcgttagtatttatggagtttatgtcctgtggtaattaaagtttct---tgttttgaaaatttgttccacaacc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46309290 |
atgttggaaatttttggcaagatatggctttagtatttatggagtttatgtcctgtggtaattaaagtttcttcttgttttgaaaatttgttccacaacc |
46309389 |
T |
|
| Q |
197 |
tatttgacctatgtagcatcaacactacacggtgaaggcgtattttgtgttatgagatgttgtttgatatctttagtataa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
46309390 |
tatttgacctatgtagcatcaacactacacggtgaaggcgtattttgtgtgatgagttgttgtttgatatctttagtataa |
46309470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 46309094 - 46309204
Alignment:
| Q |
14 |
attattttactttttggatcgacgcttattttgtgactgttgatatggttgtatggtgtaattaaatagcaacaccttatgtgtttatgttggaaatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46309094 |
attattttactttttggatcgacgcttattttgtgaacggtgatatggttgtatggtgtaattaaatagcaacaccttatgtgtttatgttggaaacttt |
46309193 |
T |
|
| Q |
114 |
tggcaagatat |
124 |
Q |
| |
|
||||||||||| |
|
|
| T |
46309194 |
tggcaagatat |
46309204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University